You are seeing a free-to-access but limited selection of the activity Altmetric has collected about this research output.
Click here to find out more.
Mendeley readers
Attention Score in Context
| Title |
Human Chromosomal Fragile Site FRA16B Is an Amplified AT-Rich Minisatellite Repeat
|
|---|---|
| Published in |
Cell, February 1997
|
| DOI | 10.1016/s0092-8674(00)81875-9 |
| Pubmed ID | |
| Authors |
Sui Yu, Marie Mangelsdorf, Duncan Hewett, Lynne Hobson, Elizabeth Baker, Helen J Eyre, Naras Lapsys, Denis Le Paslier, Norman A Doggett, Grant R Sutherland, Robert I Richards |
| Abstract |
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats). |
Mendeley readers
The data shown below were compiled from readership statistics for 37 Mendeley readers of this research output. Click here to see the associated Mendeley record.
Geographical breakdown
| Country | Count | As % |
|---|---|---|
| United States | 2 | 5% |
| Russia | 1 | 3% |
| France | 1 | 3% |
| Unknown | 33 | 89% |
Demographic breakdown
| Readers by professional status | Count | As % |
|---|---|---|
| Researcher | 9 | 24% |
| Student > Ph. D. Student | 7 | 19% |
| Professor > Associate Professor | 6 | 16% |
| Professor | 3 | 8% |
| Student > Doctoral Student | 2 | 5% |
| Other | 5 | 14% |
| Unknown | 5 | 14% |
| Readers by discipline | Count | As % |
|---|---|---|
| Agricultural and Biological Sciences | 18 | 49% |
| Biochemistry, Genetics and Molecular Biology | 10 | 27% |
| Medicine and Dentistry | 2 | 5% |
| Arts and Humanities | 1 | 3% |
| Immunology and Microbiology | 1 | 3% |
| Other | 1 | 3% |
| Unknown | 4 | 11% |
Attention Score in Context
This research output has an Altmetric Attention Score of 6. This is our high-level measure of the quality and quantity of online attention that it has received. This Attention Score, as well as the ranking and number of research outputs shown below, was calculated when the research output was last mentioned on 08 July 2014.
All research outputs
#5,446,994
of 25,374,917 outputs
Outputs from Cell
#9,814
of 17,168 outputs
Outputs of similar age
#8,633
of 93,677 outputs
Outputs of similar age from Cell
#40
of 70 outputs
Altmetric has tracked 25,374,917 research outputs across all sources so far. Compared to these this one has done well and is in the 75th percentile: it's in the top 25% of all research outputs ever tracked by Altmetric.
So far Altmetric has tracked 17,168 research outputs from this source. They typically receive a lot more attention than average, with a mean Attention Score of 59.1. This one is in the 33rd percentile – i.e., 33% of its peers scored the same or lower than it.
Older research outputs will score higher simply because they've had more time to accumulate mentions. To account for age we can compare this Altmetric Attention Score to the 93,677 tracked outputs that were published within six weeks on either side of this one in any source. This one has done well, scoring higher than 84% of its contemporaries.
We're also able to compare this research output to 70 others from the same source and published within six weeks on either side of this one. This one is in the 18th percentile – i.e., 18% of its contemporaries scored the same or lower than it.