| Title |
Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of α-Amy2 genes
|
|---|---|
| Published in |
Plant Molecular Biology, November 1995
|
| DOI | 10.1007/bf00041160 |
| Pubmed ID | |
| Authors |
Paul J. Rushton, Heather Macdonald, Alison K. Huttly, Colin M. Lazarus, Richard Hooley |
| Abstract |
The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. |
Mendeley readers
The data shown below were compiled from readership statistics for 78 Mendeley readers of this research output. Click here to see the associated Mendeley record.
Geographical breakdown
| Country | Count | As % |
|---|---|---|
| France | 1 | 1% |
| Unknown | 77 | 99% |
Demographic breakdown
| Readers by professional status | Count | As % |
|---|---|---|
| Student > Ph. D. Student | 23 | 29% |
| Researcher | 13 | 17% |
| Student > Master | 7 | 9% |
| Student > Bachelor | 6 | 8% |
| Professor > Associate Professor | 4 | 5% |
| Other | 6 | 8% |
| Unknown | 19 | 24% |
| Readers by discipline | Count | As % |
|---|---|---|
| Agricultural and Biological Sciences | 37 | 47% |
| Biochemistry, Genetics and Molecular Biology | 15 | 19% |
| Engineering | 2 | 3% |
| Psychology | 1 | 1% |
| Environmental Science | 1 | 1% |
| Other | 2 | 3% |
| Unknown | 20 | 26% |
Attention Score in Context
This research output has an Altmetric Attention Score of 6. This is our high-level measure of the quality and quantity of online attention that it has received. This Attention Score, as well as the ranking and number of research outputs shown below, was calculated when the research output was last mentioned on 20 June 2013.
All research outputs
#5,412,614
of 22,893,031 outputs
Outputs from Plant Molecular Biology
#391
of 2,845 outputs
Outputs of similar age
#3,179
of 25,374 outputs
Outputs of similar age from Plant Molecular Biology
#9
of 51 outputs
Altmetric has tracked 22,893,031 research outputs across all sources so far. Compared to these this one has done well and is in the 76th percentile: it's in the top 25% of all research outputs ever tracked by Altmetric.
So far Altmetric has tracked 2,845 research outputs from this source. They receive a mean Attention Score of 4.3. This one has gotten more attention than average, scoring higher than 69% of its peers.
Older research outputs will score higher simply because they've had more time to accumulate mentions. To account for age we can compare this Altmetric Attention Score to the 25,374 tracked outputs that were published within six weeks on either side of this one in any source. This one has gotten more attention than average, scoring higher than 74% of its contemporaries.
We're also able to compare this research output to 51 others from the same source and published within six weeks on either side of this one. This one has gotten more attention than average, scoring higher than 58% of its contemporaries.