| Title |
Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children
|
|---|---|
| Published in |
Immunogenetics, September 2015
|
| DOI | 10.1007/s00251-015-0864-z |
| Pubmed ID | |
| Authors |
Inna G. Ovsyannikova, Hannah M. Salk, Beth R. Larrabee, V. Shane Pankratz, Gregory A. Poland |
| Abstract |
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future. |
X Demographics
The data shown below were collected from the profile of 1 X user who shared this research output. Click here to find out more about how the information was compiled.
Geographical breakdown
| Country | Count | As % |
|---|---|---|
| Unknown | 1 | 100% |
Demographic breakdown
| Type | Count | As % |
|---|---|---|
| Members of the public | 1 | 100% |
Mendeley readers
The data shown below were compiled from readership statistics for 18 Mendeley readers of this research output. Click here to see the associated Mendeley record.
Geographical breakdown
| Country | Count | As % |
|---|---|---|
| Unknown | 18 | 100% |
Demographic breakdown
| Readers by professional status | Count | As % |
|---|---|---|
| Student > Bachelor | 5 | 28% |
| Professor | 2 | 11% |
| Lecturer | 1 | 6% |
| Student > Master | 1 | 6% |
| Professor > Associate Professor | 1 | 6% |
| Other | 1 | 6% |
| Unknown | 7 | 39% |
| Readers by discipline | Count | As % |
|---|---|---|
| Biochemistry, Genetics and Molecular Biology | 3 | 17% |
| Medicine and Dentistry | 3 | 17% |
| Immunology and Microbiology | 3 | 17% |
| Agricultural and Biological Sciences | 1 | 6% |
| Unknown | 8 | 44% |
Attention Score in Context
This research output has an Altmetric Attention Score of 1. This is our high-level measure of the quality and quantity of online attention that it has received. This Attention Score, as well as the ranking and number of research outputs shown below, was calculated when the research output was last mentioned on 05 January 2016.
All research outputs
#20,300,248
of 22,837,982 outputs
Outputs from Immunogenetics
#1,118
of 1,203 outputs
Outputs of similar age
#224,408
of 267,090 outputs
Outputs of similar age from Immunogenetics
#8
of 12 outputs
Altmetric has tracked 22,837,982 research outputs across all sources so far. This one is in the 1st percentile – i.e., 1% of other outputs scored the same or lower than it.
So far Altmetric has tracked 1,203 research outputs from this source. They receive a mean Attention Score of 4.0. This one is in the 1st percentile – i.e., 1% of its peers scored the same or lower than it.
Older research outputs will score higher simply because they've had more time to accumulate mentions. To account for age we can compare this Altmetric Attention Score to the 267,090 tracked outputs that were published within six weeks on either side of this one in any source. This one is in the 1st percentile – i.e., 1% of its contemporaries scored the same or lower than it.
We're also able to compare this research output to 12 others from the same source and published within six weeks on either side of this one. This one is in the 1st percentile – i.e., 1% of its contemporaries scored the same or lower than it.